ر رفت.

فصل چهارم

نتايج و يافته ها

4- نتايج و يافته ها
4-1- بررسي کيفيت DNA هاي استخراج شده
کيفيت DNA هاي استخراج شده بوسيله ژل آگارز 1% و با استفاده از دستگاه Picodrop بررسي گرديد. در تصوير 4-1 کيفيت تعدادي از نمونه هاي DNA استخراج شده بر روي ژل آگارز 1% نشان داده شده است. نمونه هاي DNA داراي غلظت بيشتر ، باند طويل تر و پر نورتري دارند.

شکل 4-1 : بررسي کيفيتDNA بر روي ژل اگاروز1%
اتتخاب پرايمر هاي مناسب براي هر پلي مورفيسم با شرايطي که در فصل2 بحث شد. يک جفت پرايمر طراحي شد با استفاده ازآنزيم هاي محدودالاثر انتخاب شده برش داده شد.
جدول 4-1 : پرايمرهاي استفاده شده و آنزيم محدودالاثر
انزيم محدودالاثر
پرايمرهاي مورد استفاده
NlaIII
AAGGAAGAGGAGACTCTGCGC

TATGTGGGTGGGTGTGTCTACAGG
Bgl II
ATAAGGGCCTTAGGACACCA

GCTACTTCTCCAGGCTCACA
BSEG1

GATGCCAGCTGGCCCTGGCACTG

ATGGAAACACCTTGCTTCTTCTCCCTC

4-2- نتايج PCR
پس از انتخاب پرايمرها برنامه PCR براي هر پرايمر بهينه سازي شد.تعداد سيکل هاي مورد نظر ، غلظت مناسب Mgcl2، دماي اتصال مناسب براي هر پرايمر مشخص شده است. جدول برنامه PCR بهينه شده براي هر جفت پرايمر
جدول 4-2 : برنامه PCR بهينه شده براي هر جفت پرايمر
مراحل PCRپرايمر
تعداد سيکل
دناتوراسيون اوليه دما(C)و مدت (دقيقه)
دناتوراسيون دما(C) مدت(ثانيه)
اتصال دما(C)
مدت(ثانيه)
طويل سازي دما(C) مدت (ثانيه)
طويل سازي نهايي دما(C) مدت(ثانيه)
VDR FOKI))
26
94مدت
4 دقيقه
94 مدت 30ثانيه
64مدت 30 ثانيه
72 مدت
30 ثانيه
72 مدت
5 دقيقه
VEGF(936)
34
94مدت
4 دقيقه
94 مدت 30ثانيه
64مدت 30 ثانيه
72 مدت
30 ثانيه
72 مدت
5 دقيقه
VEGF(2578)
35
94مدت
4 دقيقه
94 مدت 30ثانيه
64مدت 30 ثانيه
72 مدت
30 ثانيه
72 مدت
5 دقيقه

پس از بهينه سازي برنامه PCR براي هر جفت پرايمر براي 150 نمونه بيمار و 100 نمونه کنترل ازمونPCR را انجام داديم.اين محصولات را بر روي ژل آگاروز 1.5%برده و با ژل رد رنگ آميزي نموده و زير نور UV اين باندها را مشاهده نموديم.براي تاييد باندهاي مورد نظر از مارکر 100bp ازشرکت ROSH استفاده کرديم. محصولات PCR با شرايط بالا را در شکلهاي زير مشاهده ميکنيم.

منفي
4
3
2
1
M

پليمورفيسم 2578باند bp476
شکل 4-2 : الکتروفورز محصول PCR براي موتاسيونA/C2578: َ1.2.3.4.: باند 476bp،.مارکر bp،100؛باندمنفي

منفي
5
4
3
2
1
M

پلي مورفيسم C/T27823باند 273bp
شکل 4 -3 : الکتروفورز محصول PCR براي پلي مورفيسم T/C 27823::باندهاي 1.2.3.4محصول PCR باند273،کنترل منفي، مارکر100bp

C
10
9
8
7
6
5
4
3
2
1
M

پليمورفيسم 936 باند 198
شکل 4-4 : الکتروفورز محصول PCR براي موتاسيون936C/T باندهاي 1.2.3 محصول PCR باند 198bp و مارکر 100bp . و کنترل منفي
4-3- نتايج RFLP
پس از تعيين صحت انجام PCR براي هر پلي مورفيسم ،RFLP بر روي محصول PCR انجام شد.به منظور RFLP از انزيم محدودالاثر و بافر مناسب آن و ميزان مناسبي از محصول PCR از آن استفاده شد.

4-3-1- پلي مورفيسم خانواده VEGF
پلي مورفيسم 2578:توسط آنزيم BgLlI برش داده مي شود. وبه قطعات 212و264 تبديل مي شود.بر روي ژل اگاروز 2% قابل مشاهده است

1
c
3
4
5
M

پلي مورفيسمA/C 2578قطعه 212.264
شکل 4-5 : الکتروفورز پس از ? RFLP?بر روي محصوالت PCR?پلي مورفيسم ? A/C 2578 ?با استفاده از??آنزيم محدوداالثر C :BgLII?قطعه تکثير شده 476 جفت باز بعنوان کنترل M- مارکر وزن مولکولي? 50 bp 4.5- هتروزيگوت?1- هموزيگوت بيمار

4-3-2- پلي مورفيسم C/T 936:
اين پلي مورفيسم داراي باند 198bp بوده که توسط انزيم NLaIII برش داده مي شود و به قطعات 112و 86bp تبديل مي شود. اين قطعات بر روي ژل 2% اگاروز مشاهده مي کنيم . براي اطمينان از برش محصولات آنها را بر روي ژل اکريل آميد برده و قطعات را مشاهده کرديم.
ا
شکل 4-6 : الکتروفورز پس ا ? RFLP?بر روي محصولات ? PCR?پلي مورفيسم ? +936C/T?با استفاده از??آنزيم محدوداالثر NlaIII I?قطعه تکثير شده 198 جفت باز بعنوان کنترل M- مارکر وزن مولکولي? 50 bp ،3، 2 ?و 6 – هتروزيگوت?5- هموزيگوت بيمار

4-3-3- پليمورفيسم FOKI
اين پلي مورفيسم داراي باند 273 است که توسط آنزيم محدودالاثر FOKIبرش خورده تبديل به قطعات 197.273.76 مي شود پس از انجام RFLP آن را بر روي ژل آگاروز 2 درصد مشاهده کرديم که در شکل پايين ديده مي شود.

C
2
3
4
M

پلي مورفيسم FOKI باندBP 273 قطعات 197+273
شکل 4-7 : الکتروفورز پس از ? RFLP?بر روي محصوالت ? PCR?پلي مورفيسم C/T?? FOKIاستفاده از??آنزيم محدوداالاثر-C :ّFOKI?قطعه تکثير شده 273 جفت باز بعنوان کنترل M- مارکر وزن مولکولي? 50 bp ،3,4 – هتروزيگوت

4-3-4- پلي مورفيسم 2578 در ژن VEGF
فراواني الل A,C در بين 150 نفر بيمار و 100 نفر فرد سالم محاسبه و بررسي شد. فراواني الل Cدر نمونه هاي بيمار 77 درصد و فراواني الل A در نمونه هاي فرد بيمار 25درصد مي باشد.در نمونه هاي افراد سالم درصد اين فراواني به ترتيب8و16مي باشد. که اختلاف معني داري بين گروه بيمار و سالم وجود دارد.

جدول 4-3 : مقايسه فرکانس اللي و ژنوتايپي پلي مورفيسم 2578
(%)
َcontrol
n=100
%))
Abortion
n=150
Allele/Genotyp257A/Cَ
0.85
170
.77
232
C
0.16
32
.25
76
A
68.3
69
68.3
80
CC
31.7
32
46.8
72
CA
0.0
0
1.3
2
AA

شکل 4-8 : مقايسه بين فرکانس اللي و ژنوتايپي کنترل و بيمار

4-3-5- پلي مورفيسمC/T 936 در ژن VEGF:
?فراواني آللهايC,Tدر150 بيمار و 100 نفر جمعيت کنترل محاسبه و مقايسه شد. براي گروه کنترل??%98 احتمال وجود آللC?و %25 احتمال وجود آللTمي باشد، و براي گروه بيمار 98%براي الل C و %0.03 براي الل T اين احتمال وجود دارد . ?همچنين فرکانس ژنوتپ هاي ?CT ،CC?و ?TT?حاصله در اين دو جمعيت نيز??بررسي شد. اختلاف معني داري بين گروه بيمار و کنترل در آللهايC?و? T?مشاهده نشد.

جدول 4-4 : جدول مقايسه اللي و ژنوتايپي کنترل و بيمار در پلي مورفيسم 936
(%)
َcontrol
n=100
%))
Abortion
=150
Allele/Genotyp936C/T
98
197
98
259
C
25
5
03
9
T
95
96
94.7
144
CC
5
5
4.6
7
CT
01
0
7
1
TT

شکل 4-9 : بررسي اللي و ژنوتايپي گروه کنترل و بيمار در پلي مورفيسم 936

4-3-6- پلي مورفيسم 27823 در ژنVDR:
?فراواني آللهايC,Tدر150 بيمار و 100 نفر جمعيت کنترل محاسبه و مقايسه شد. براي گروه کنترل78% احتمال وجود آلل ?C?و 22% احتمال وجود آلل ?Tمي باشد، و براي گروه بيمار 72 و 0.03درصد??بترتيب براي آللهاي ?C,?T? همچنين فرکانس ژنوتايپ هاي ?CT ،CC?و TT?حاصله در اين دو جمعيت نيز??بررسي شد. اختلاف معني داري بين گروه بيمار و کنترل در آللهايC?و ? T?مشاهده نشد.

جدول 4-5 : بررسي اللي و ژنوتايپي 27823 در گروه کنترل و بيمار
(%)
َcontrol
n=100
%))
Abortion
=150
Allele/Genotyp27823C/T
78
157
72
218
C
22
45
3
90
T
64
65
54.5
84
CC
26.7
27
32.5
50
CT
8.9
9
13
20
TT

شکل4-10 : بررسي گروه اللي و ژنوتايپي پلي مورفيسم 27823

4-3-7- بررسي سطح سرمي ويتامين D باپلي مورفيسم FOKIدر ژن رسپتور ويتامين D:
سطح سرمي ويتامين D افرادي که در اين گروه مورد مطاله قرار گرفتند و داراي ژنوتيپ نرمال مي باشد 14.6+_13.2 ،افرادي که ژنوتيپ هتروزيگوت دارند 5.08_+ 8.6020و در گروه هموزيگوت 6.8+_11.8مي باشد. بررسي اماري سطح سرمي ويتامين D در اين سه گروه ژنوتيپي پلي مورفيسم FOKI به وسيله تست ANOVA ارتباط معني داري را نشان نداده است.P=0.234

جدول 4-6 : سطح سرمي ويتامين D
Sero vitamin D3
VDR FOKI
normal
Nsufficienncy
Dificiency

57.1%
56%
55%
NORMAL
14.3%
31.4%
34.4%
Hetrozygot
28.6%
11.4%
9.8%
Homozyg

سطح سرمي ويتامين D3 در Dificiencyکمتر از 10 , insufficienncyبين 30-10 و حالت نرمال 100-30 قرار گرفته است که 50 درصد افراد مورد مطالعه در اين |پژوهش در بازه ي کمتر از 10 قرار گرفتند.

4-4- بررسي نتايج آماري:
با توجه به نتايج مشاهده شده لکتروفورز محصول ? RFLP?بر روي ژل آگارز 5/2 % ژنوتيپ هر فرد?براي هر پلي مورفيسم مشخص شد. ?پس از تعيين فراواني ژنوتيپها براي هر دو گروه بيمار وکنترل ، بررسي هاي آماري با استفاده از نرم افزار SPSS ??(ver: 13.00) ? بر روي اطالعات بدست آمده انجام شد.?

?براي سه حالت هتروزيگوت ،هموزيگوت ؛نرمال اين آزمون انجام شد. که براي پلي مورفيسم 2578 داراي ارتباط معني داري بوده است.
جدول 4-7 : بررسي فراواني پلي مورفيسم هاي 2578و936.27823?
??
نمونه
شاهد
P_value
پلي مورفيسم
نرمال
هتروزيگوت
هموزيگوت
نرمال
هتروزيگوت
هموزيگوت
MAN-vitny
Chi-squre
2578A/G
68.3
80
46.8
72
1.3
2
96
95%
5
5%
0
.1%
0.008
0.02
936C/T
144
97%
7

دسته بندی : No category

دیدگاهتان را بنویسید