قطعاتي مشابهي از توالي? ?است که امتياز همرديفي آن ها از يک حد آستانه مشخصي با?تر باشد. اين قطعات??(?HSPs (high-scoring segment pairs?ناميده مي شوند. .براي اين برنامه ?BLAST???از روش?Dynamic Programming?استفاده ميشود. ?وارد کردن توال? به منظور جستجو در صفحه ?BLAST?? ?به طور معمول در تحقيقات ما دارا? ?ک توال? اوليه مستقيم که م? خواهيم??توال?ها? مشابه آن را از طر?ق جستجو? در بانكهاي اط?عاتي به دست آور?م .?
?تبد?ل فرمت ها و ذخيره ساز??
?در ا?ن مرحله م? توانيم بسته به نيازمان توال? ?ا اط?عات آن را ذخيره کنيم. نوع? ?فرمت ذخيره ا? را از منو? display?مشخص م? کنيم. به عنوان مثال اگر همه ?? ?اط?عات مورد نياز ما باشد از فرمتgenepet?استفاده م? کنيم و از طريق کشوي ??send? به صورت ? file? ذخيره ميکنيم.
.
شکل3-3 : نرم افزار بلاست
در بررسي با نرمافزار Gene Runner،خصوصيات فيزيکي پرايمرها مورد بررسي قرار ميگيرد

شکل 3-4 : با نرمافزار Gene Runner
شکل 3-4 – با نرمافزار Gene Runnerدرصد گوانين- سيتوزين(GC%)، dG براي دايمر،Hairpin loops وInternal loops بررسي مي شودقطعه اي از ژن را که داراي آن SNP خاص ميباشد تکثير نموده و سپس به کمک آنزيم محدودکنندهاي که SNP مورد نظر درون توالي مورد شناسايي آنزيم قراردارد را با توجه به برش يا عدم برش توسط آنزيم تعيين کرد. پس از انتخاب جفت پرايمر مناسب به منظور ژنوتايپ کردن هر نمونه براي هر کدام از پليمورفيسم ها بايستي واکنش PCR براي هر جفت پرايمر بهينه شود.در اين بررسي پلي مورفيسم هاي ژنVDR.(Fok1.BSM1) VEGF(936,2578) موردارزيابي قرار گرفتند به همين منظور جهت PCR آنها يک جفت پرايمر با توالي زير طراحي شد که در جدول 3-2 مي توان مشخصات آنها مشاهده نمود.
جدول 3-2 : مشخصات پرايمر
نام ژن
پلي مورفيسم
توالي پرايمر
محصول PCR
آنزيم محدود کننده
محصول RFLP
VEGF
939
AAGGAAGAGGAGACTCTGCGC
TATGTGGGTGGGTGTGTCTACAGG
198
NlaIII
(112,86) *
(112,86,198) **

2578
ATAAGGGCCTTAGGACACCA
GCTACTTCTCCAGGCTCACA

477
Bgl II
(212,264) *
(477,212.264)
VDR
( GA )
(60890) BsmI
GCGATTCGTAGGGGGGATTCTG
TCTCCATTCCTTGAGCCTCCAGTCC

403
Bsm1
(67,336) *
(403,336,67)

TC
(27823) FokI_R
GATGCCAGCTGGCCCTGGCACTG
ATGGAAACACCTTGCTTCTTCTCCCTC
273
Fok1
(197.76)*
(97,76,273)

3-5- واکنش زنجيرهاي پلي مراز.
براي بررسي پلي مورفيسم هاي اين ژن با پرايمر ذکر شده در بالا، احتياج به بهينه سازي واکنش PCRبود. به همين منظور در ابتدا گراديان دما که در آن فقط شرايط دمايي بين ميکروتيوبها متفاوت بود صورت گرفت و دماي 60 درجه سانتيگراد به عنوان بهترين دماي اتصال Annealing پرايمر به توالي هدف بدست آمد. سپس براي بدست آوردن بهترين باند، گراديان MgCl2 با ثابت نگه داشتن بقيه شرايط صورت گرفت که در آنMg با غلظت نهايي 1.5ميلي مولار انتخاب شد و بدين ترتيب واکنش PCR مورد نظر بهينه شد.

3-5-1- مواد و وسايل لازم
جدول 3-3 :مواد لازم براي واکنش پلي مراز
1- ( Cinnagen,Iran) PCR reaction buffer(10?)
2- ( Cinnagen,Iran )( 5U/ul) ) Taq DNA Polymeras
3- Cinnagen,Iran)) ( (50mM MgCl2
4-( Roche,Germany ) (10 mM) ) dNTPS mix
5- (Bioneer,Korea)-Forward primer(10 Pmol/ul)
6-( Bioneer,Korea ) -Reverse primer(10 Pmol/ul)
7- آب مقطر دوبار تقطير استريل
8- سمپلر متغير (Germany ) (1-10 ul,10-100 ul,100-1000 ul) Eppendorf
9- ميکروتيوب ul2/0 عاري از DNAase و ( Trefflab,Germany) RNAase
10- دستگاه ترموسيکلرGermany))Eppendorf master cycler gradient))

3-5-2- روش کار
ابتدا در ميکروتيوب ml 5/0 master mix تهيه شد. نوع و ترکيب مواد بکار رفته در جدول 3-2 آورده شده است:

جدول 3-4 : حجم و غلظت مواد بکار رفته در PCR
مواد
غلظت نهايي39
غلظت
مقدار مورد نياز
DDW


ul55/17
10x PCR Buffer
?1
?10
ul5/2
MgCl2
mM5/1
mM50
ul75/0
dNTP Mix
mM4/0
mM10
ul1
NAT2- Forward primer
Pmol4/0
Pmol/ul10
ul1
NAT2-Reverse primer
Pmol4/0
Pmol/ul10
ul1
Taq DNA Polymerase
U/ul04/0
U/ ?l5
ul2/0

به هر يک از ميکروتيوب هامقداري از ml2/0 Master mix آماده شده اضافه شد و سپس به اندازه ul1 از نمونه هاي DNA استخراج شده مورد نظر که از آنها رقتهاي ng/ul 50 تهيه شده بود اضافه شد تا حجم نهايي هر واکنش ul25شود، لازم به ذکر است در حين انجام PCR ويال کنترل منفي و ويال کنترل مثبت هم لحاظ شد که در ويال کنترل منفي ul 1 آب مقطر بجاي DNA ريخته شد و لزوم بودن ويال کنترل منفي درواکنش PCR جهت بررسي آلودگي در اين کار ميباشد. ويال کنترل مثبت هم حاوي ul 1از DNA اي است که قبلا تست شده و جواب گرفتن آن در واکنش PCR تاييد شده است. لزوم بودن اين ويال هم در PCR به جهت تاييدي بر صحت انجام واکنش PCR مي باشد.پس ازاليکه نمودن Master mix ويال ها داخل دستگاه ترموسيکلر قرارگرفتند و بر طبق پروتوكل دمايي زير تكثير شدند :
جدول 3-5 : برنامه زماني PCR مورد استفاده در دستگاه ترموسيکلر
مراحلPCRپرايمر
تعداد سيکل
دناتوراسيون اوليه دما(Cْ) و مدت (دقيقه))
دناتوراسيون دما(Cْ) و مدت (ثانيه))
اتصال دما(Cْ) ومدت (ثانيه))
طويل سازي دما(Cْ) ومدت (ثانيه))
طويل سازي نهايي دما(Cْ) ومدت (دقيقه))
ميزان MgCl2
براي هر Master Mix(µl)
2587
40
94 (3)
94 (30)
57 (30)
72 (30)
72 (7)
5/1
936
35
94 (3)
94 (60)
62 (60)
72 (60)
72 (10)
2
60890
30
94 (3)
94 (30)
60 (30)
72 (40)
72 (10)
5/1
27823
35
94 (3)
94 (30)
9/62 (43)
72 (45)
72 (5)
2
پس از پايان برنامه، نمونه ها تا زمان بررسي نتيجه PCR روي ژل آگارز%5/1 در دماي 4 درجه سانتيگراد نگهداري شد.

3-5-3- الکتروفورز ژل آگارز
به سبب اينکه DNA جزو ملکول هاي زيستي باردار مي باشد مي توان با قرار دادن آنها در يک ميدان الکتريکي ،آنها را بر اساس وزن مولکولي تفکيک کرد. براي اين منظور از روشي بنام الکتروفورز استفادمي شود. صحت PCR با انجام الكتروفورز براي محصولات PCR بر روي ژل آگارز 5/1% پس از رنگ آميزي ژل ردزير نور UV تاييد شد.

جدول 3-6 : مواد لازم براي تهيه بافر
تريس Sweden)( Tris base))
اسيد استيک گلاسيال ( Merck, Germany) ( CH3COOH)
( Plusone, Sweden) EDTA
GEL RED ( Roche, Germany)
برموفنل بلو ( Merck, Germany)
گليسرول(( Merck, Germany)(C3H8O3
آگارز (Agarose- LE) ( USB, USA)
تانک الکتروفورز افقي ( Bio-Rad ,United States
مارکر

3-5-4- طرز تهيه بافر ?1
ابتدا بافر TAE بصورت ?50 تهيه شد و سپس براي آگارز يک پلي ساکاريد است که از واحدهاي تکرار شونده دي ساکاريد آرابينوز تشکيل شده است .هنگامي که پودر آگارز در اثر حرارت در بافر خود به حالت ژل درميآيد در واقع شکل مولکولهاي پليمر، از حالت حلقوي نامنظم به شکل مولکولهاي مارپيچي دوتايي درميآيند. اين پديده يک شبکه از منافذ با قطر 100 تا 300 نانومتر توليد ميکند که اندازه اين منافذ به عوامل متفاوتي بستگي دارد. غلظت بالاتر آگارز منافذ ريزتر بوجود مي آورد.و قدرت تفکيک اين ژل ها تاحدودي با غلظت آنها رابطه مستقيمي دارد. براي مثال ، براي تفکيک قطعاتي به اندازه 100 جفت باز از آگاروز 3% و براي قطعات حدود 2000 جفت باز از آگارز 8/0% درصد استفاده مي شود. براي تهيه ژل هر بار، با استفاده ازآب مقطر رقيق شده ، غلظتx1 از آن تهيه شد.
طرز تهيه بافر ? 50 بصورت زير مي باشد:
121گرم تريس ، ml5/28 اسيد استيک گلاسيال و ml 50 از, EDTA mM 5/0 مخلوط شده و حجم نهايي با آب مقطر به ml 500 رسيد. براي تهيه بافر? 1 که در واقع محلول کار مي باشدml 20 از بافر x50 را برداشته و با آب مقطر به حجم يک ليتر مي رسانيم.
لازم به ذکر است که تنظيم pH درEDTA روي عدد 8 نکته مهمي در تهيه بافر ?50 مي باشد.

3-5-5- طرز تهيه ژل آگارز
آگارز برحسب اندازه ژل مورد نظر، مقدار کافي آگارز در حجمي متناسب از بافر از بافر? 1TAE رقيق شده، به کمک حرارت حل شد و محلولي کاملا شفاف بدست آمد.)در اين جا ژل 5/1%تهيه شد که 5/1 گرم آگارز درml 100 از? 1 TAE به کمک حرارت حل شد). پس از خنک شدن محلول تا حدود?c 50، ul1 از ا به آن اضافه شده و در قالبي که قبلاً شانه در آن قرار گرفته بود ريخته شد.

3-5-6- روش کار جهت Run کردن نمونه ها روي ژل آگارز
يک روش متداول تشخيص و تخليص قطعات DNA ، محصولات PCR و غيره الکتروفورز نمونه هادر ژل آگارز است. پس از خنک شدن ژل آگارز و آماده شدن آن را در تانک الکتروفورز محتوي بافر ?1TAE قرارداده و درهريک از چاهکهاي تعبيه شده در ژل مخلوطي ازul DNA 2ياul 5 از محصولات PCR را که با ul2 از لودينگ بافر مخلوط شده است را ميريزيم و سپس تانک الکتروفورز به جريان برق متصل شد و با ولتاژ 90 ولت الکتروفورز شد. پس از گذشت حدود 30 دقيقه نتايج به کمک دستگاه UV تاييد شده و عکس تهيه گرديد.

3-6- چندشکلي در طول قطعات محدود40
آنزيمهاي محدود کننده توالي هاي شناسايي ويژه اي در DNA دارند و در نتيجه تغييرات توالي در DNA ژنومي منجر به ايجاد يا شکسته شدن ويژه اي مي شوند و لذا اندازه يک يا بيشتر قطعات DNA را تغيير مي دهند آنزيم هاي اين مطالعه بوسيله نرمافزار بيوانفورماتيک در سايت NEB Cutter بررسي ميشوند تنوعات موجود بر پايه DNA در محلهاي محدودکننده چندشکلي در طول قطعات محدودRFLP ناميده مي شوند. RFLP ها ممکن است بيشتر از يک قطعه از يک تغيير نوکلئوتيدي منفرد، از حذف يا الحاق ناشي شود. اگر يک قطعه از DNAبين دو محل محدود کننده دچار حذف يا اضافه شود، اندازه قطعه محدود کننده حاصل متفاوت خواهد بود. RFLP هاي ناشي از تغييرات در محل هاي شکسته شدن اندونوکلئاز محدودکننده ويژه، يک زيرگروه کوچک از طبقه کلي تر پلي مورفيسم هستند که پليمورفيسمهاي نوکلئوتيد منفرد41 (SNPs) ناميده ميشوند. SNP ها به طور يکنواخت و شايعي در تمامي ژنوم منتشر هستند. اين مشخصات آنها را نشانگرهاي بسيار عالي ژنتيکي براي تشخيص مولکولي ميکنند

شکل 3-5 : نرم افزار Neb cutter

3-7- روش انجام RFLP بر روي محصولات PCR
به منظور RFLP برروي محصول PCR هر جفت پرايمر، از آنزيم محدودالاثر42 (RE)و بافر (10X) مناسب آن و ميزان مناسبي از محصول PCR استفاده مي شود.
1. بافر (مناسب هر آنزيم) (10X): µl 1
2. محصول PCR: µl 7
3. آنزيم محدودالاثر: µl 1
4. آب مقطر ديونيزه دو بار تقطير: µl 1
* حجم نهايي µl 10
براي بررسي نتيجه RFLP، از الکتروفورز بر روي ژل آگارز براي مقايسه دقيق طول باندها استفاده شد. با توجه به نتايج مشاهده شده بر روي ژل آگارز، ژنوتيپ هر فرد براي هر پليمورفيسم مشخص در دراين شکل ژل اگاروز را مشاهده مي کنيم.
.
شکل 3-6 : مشاهده ژل آگاروز

3-8- روشهاي آماري مورد استفاده
اطلاعات بدست آمده توسط نرم افزار SPSS بررسي شد. چگونگي وقوع اين پليمورفيسم به سه حالت نرمال، هتروزيگوت و هموزيگوت در دو گروه بيمار و شاهد با استفاده از آزمون ?2 و Mann-Whitney بررسي شد. نتايج با 05/0 p-value معني دار تلقي گرديدند. سپس با ادغام دو گروه هموزيگوت و هتروزيگوت، گروه جديدي ايجاد شد. جهت بررسي اثر هر پليمورفيسم بر وقوع سقط مکرر از مدل رگرسيون لجستيک يک متغيره استفاده شد. سپس جهت بررسي اثر همزمان موتاسيونها بر شانس وقوع سقط مکرر از مدل رگرسيون لجستيک چندگانه به روش پس رو بکار

دسته بندی : No category

دیدگاهتان را بنویسید